alvinalexander.com | career | drupal | java | mac | mysql | perl | scala | uml | unix  

Groovy example source code file (fasta.java)

This example Groovy source code file (fasta.java) is included in the DevDaily.com "Java Source Code Warehouse" project. The intent of this project is to help you "Learn Java by Example" TM.

Java - Groovy tags/keywords

homo, homosapiens, ia, ic, im, io, ioexception, ioexception, iub, line_length, line_length, outputstream, outputstream, string, string

The Groovy fasta.java source code

/*
 * The Great Computer Language Shootout 
 * http://shootout.alioth.debian.org/
 * 
 * modified by Mehmet D. AKIN
 *
 */

import java.io.IOException;
import java.io.OutputStream;

class fasta {
    public static final int IM = 139968;
    public static final int IA = 3877;
    public static final int IC = 29573;
    public static int last = 42;

    public static final int LINE_LENGTH = 60;

    // pseudo-random number generator
    public static final double random(double max) {
        last = (last * IA + IC) % IM;
        return max * last / IM;
    }

    // Weighted selection from alphabet
    public static String ALU = 
              "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
            + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
            + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
            + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
            + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
            + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
            + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
    public static byte[] ALUB = ALU.getBytes(); 

    public static final frequency[] IUB = new frequency[] {
            new frequency('a', 0.27), 
            new frequency('c', 0.12),
            new frequency('g', 0.12), 
            new frequency('t', 0.27),
            
            new frequency('B', 0.02), 
            new frequency('D', 0.02),
            new frequency('H', 0.02), 
            new frequency('K', 0.02),
            new frequency('M', 0.02), 
            new frequency('N', 0.02),
            new frequency('R', 0.02), 
            new frequency('S', 0.02),
            new frequency('V', 0.02), 
            new frequency('W', 0.02),
            new frequency('Y', 0.02) };

    public static final frequency[] HomoSapiens = new frequency[] {
            new frequency('a', 0.3029549426680d),
            new frequency('c', 0.1979883004921d),
            new frequency('g', 0.1975473066391d),
            new frequency('t', 0.3015094502008d)};

    public static void makeCumulative(frequency[] a) {
        double cp = 0.0;
        for (int i = 0; i < a.length; i++) {
            cp += a[i].p;
            a[i].p = cp;
        }
    }

    // naive
    public final static byte selectRandom(frequency[] a) {
        int len = a.length;
        double r = random(1.0);
        for (int i = 0; i < len; i++)
            if (r < a[i].p)
                return a[i].c;
        return a[len - 1].c;
    }

    static int BUFFER_SIZE = 1024;
    static int index = 0;
    static byte[] bbuffer = new byte[BUFFER_SIZE];
    static final void makeRandomFasta(String id, String desc,frequency[] a, int n, OutputStream writer) throws IOException
    {
        index = 0;
        int m = 0;
        String descStr = ">" + id + " " + desc + '\n'; 
        writer.write(descStr.getBytes());
        while (n > 0) {
            if (n < LINE_LENGTH) m = n;  else m = LINE_LENGTH;
            if(BUFFER_SIZE - index < m){
                writer.write(bbuffer, 0, index);
                index = 0;
            }
            for (int i = 0; i < m; i++) {
                bbuffer[index++] = selectRandom(a);
            }
            bbuffer[index++] = '\n';
            n -= LINE_LENGTH;
        }
        if(index != 0) writer.write(bbuffer, 0, index);
    }    
    
    static final void makeRepeatFasta(String id, String desc, String alu, int n, OutputStream writer) throws IOException
    {
        index = 0;
        int m = 0;
        int k = 0;
        int kn = ALUB.length;
        String descStr = ">" + id + " " + desc + '\n'; 
        writer.write(descStr.getBytes());
        while (n > 0) {
            if (n < LINE_LENGTH) m = n; else m = LINE_LENGTH;
            if(BUFFER_SIZE - index < m){
                writer.write(bbuffer, 0, index);
                index = 0;
            }
            for (int i = 0; i < m; i++) {
                if (k == kn) k = 0;
                bbuffer[index++] = ALUB[k];
                k++;
            }
            bbuffer[index++] = '\n';
            n -= LINE_LENGTH;
        }
        if(index != 0) writer.write(bbuffer, 0, index);
    }
    
    public static void main(String[] args) throws IOException {
        makeCumulative(HomoSapiens);
        makeCumulative(IUB);
        int n = 2500000;
        if (args.length > 0)
            n = Integer.parseInt(args[0]);
        OutputStream out = System.out;
        makeRepeatFasta("ONE", "Homo sapiens alu", ALU, n * 2, out);
        makeRandomFasta("TWO", "IUB ambiguity codes", IUB, n * 3, out);
        makeRandomFasta("THREE", "Homo sapiens frequency", HomoSapiens, n * 5, out);
        out.close();
    }

    public static class frequency {
        public byte c;
        public double p;

        public frequency(char c, double p) {
            this.c = (byte)c;
            this.p = p;
        }
    }
}

Other Groovy examples (source code examples)

Here is a short list of links related to this Groovy fasta.java source code file:

... this post is sponsored by my books ...

#1 New Release!

FP Best Seller

 

new blog posts

 

Copyright 1998-2024 Alvin Alexander, alvinalexander.com
All Rights Reserved.

A percentage of advertising revenue from
pages under the /java/jwarehouse URI on this website is
paid back to open source projects.