Scala example source code file (fasta.scala)

This example Scala source code file (fasta.scala) is included in the DevDaily.com "Java Source Code Warehouse" project. The intent of this project is to help you "Learn Java by Example" ^TM.

Java - Scala tags/keywords

array, array, byte, double, homo, ia, im, im, io, iub, linelength, linelength, pair, pair, randomnumber

The Scala fasta.scala source code

/* The Computer Language Shootout
   http://shootout.alioth.debian.org/
   contributed by Isaac Gouy
*/

import java.io._

object fasta { 
   def main(args: Array[String]) = {

      val ALU =
         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
         "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
         "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
         "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
         "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
         "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
         "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"

      val _IUB = Array(
         Pair('a', 0.27), 
         Pair('c', 0.12), 
         Pair('g', 0.12), 
         Pair('t', 0.27), 

         Pair('B', 0.02), 
         Pair('D', 0.02),
         Pair('H', 0.02), 
         Pair('K', 0.02), 
         Pair('M', 0.02),
         Pair('N', 0.02), 
         Pair('R', 0.02), 
         Pair('S', 0.02),
         Pair('V', 0.02), 
         Pair('W', 0.02), 
         Pair('Y', 0.02)
      )

      val IUB = makeCumulative(_IUB)

      val _HomoSapiens = Array(
         Pair('a', 0.3029549426680), 
         Pair('c', 0.1979883004921),
         Pair('g', 0.1975473066391), 
         Pair('t', 0.3015094502008)
      )

      val HomoSapiens = makeCumulative(_HomoSapiens)


      val n = Integer parseInt(args(0))
      val s = new FastaOutputStream(System.out)

      s.writeDescription("ONE Homo sapiens alu")
      s.writeRepeatingSequence(ALU,n*2)

      s.writeDescription("TWO IUB ambiguity codes")
      s.writeRandomSequence(IUB,n*3)

      s.writeDescription("THREE Homo sapiens frequency")
      s.writeRandomSequence(HomoSapiens,n*5)

      s.close
   } 

   def makeCumulative(a: Array[Pair[Char,Double]]) = {
      var cp = 0.0
      a map (frequency =>
         frequency match { 
            case Pair(code,percent) => 
               cp = cp + percent; new Frequency(code.toByte,cp) 
         } 
      )
   }

}


// We could use instances of Pair or Tuple2 but specific labels
// make the code more readable than index numbers

class Frequency(_code: Byte, _percent: Double){ 
   var code = _code; var percent = _percent;
}


// extend the Java BufferedOutputStream class

class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) {

   private val LineLength = 60
   private val nl = '\n'.toByte

   def writeDescription(desc: String) = { write( (">" + desc + "\n").getBytes ) }

   def writeRepeatingSequence(_alu: String, length: Int) = {
      val alu = _alu.getBytes
      var n = length; var k = 0; val kn = alu.length;

      while (n > 0) {
         val m = if (n < LineLength) n else LineLength

         var i = 0
         while (i < m){ 
            if (k == kn) k = 0
            val b = alu(k)
            if (count < buf.length){ buf(count) = b; count = count + 1 }
            else { write(b) } // flush buffer
            k = k+1
            i = i+1 
         }

         write(nl)
         n = n - LineLength
      }

   }

   def writeRandomSequence(distribution: Array[Frequency], length: Int) = {
      var n = length
      while (n > 0) {
         val m = if (n < LineLength) n else LineLength

         var i = 0
         while (i < m){ 
            val b = selectRandom(distribution)
            if (count < buf.length){ buf(count) = b; count = count + 1 }
            else { write(b) } // flush buffer
            i = i+1 
         }

         if (count < buf.length){ buf(count) = nl; count = count + 1 }
         else { write(nl) } // flush buffer
         n = n - LineLength
      }
   }

   private def selectRandom(distribution: Array[Frequency]): Byte = {
      val n = distribution.length
      val r = RandomNumber scaledTo(1.0)

      var i = 0
      while (i < n) {
         if (r < distribution(i).percent) return distribution(i).code
         i = i+1
      }
      return distribution(n-1).code
   }
}


object RandomNumber {
   private val IM = 139968
   private val IA = 3877
   private val IC = 29573
   private var seed = 42

   def scaledTo(max: Double) = {
      seed = (seed * IA + IC) % IM
      max * seed / IM
   }
}