|
Scala example source code file (fasta.scala)
The Scala fasta.scala source code/* The Computer Language Shootout http://shootout.alioth.debian.org/ contributed by Isaac Gouy */ import java.io._ object fasta { def main(args: Array[String]) = { val ALU = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" val _IUB = Array( Pair('a', 0.27), Pair('c', 0.12), Pair('g', 0.12), Pair('t', 0.27), Pair('B', 0.02), Pair('D', 0.02), Pair('H', 0.02), Pair('K', 0.02), Pair('M', 0.02), Pair('N', 0.02), Pair('R', 0.02), Pair('S', 0.02), Pair('V', 0.02), Pair('W', 0.02), Pair('Y', 0.02) ) val IUB = makeCumulative(_IUB) val _HomoSapiens = Array( Pair('a', 0.3029549426680), Pair('c', 0.1979883004921), Pair('g', 0.1975473066391), Pair('t', 0.3015094502008) ) val HomoSapiens = makeCumulative(_HomoSapiens) val n = Integer parseInt(args(0)) val s = new FastaOutputStream(System.out) s.writeDescription("ONE Homo sapiens alu") s.writeRepeatingSequence(ALU,n*2) s.writeDescription("TWO IUB ambiguity codes") s.writeRandomSequence(IUB,n*3) s.writeDescription("THREE Homo sapiens frequency") s.writeRandomSequence(HomoSapiens,n*5) s.close } def makeCumulative(a: Array[Pair[Char,Double]]) = { var cp = 0.0 a map (frequency => frequency match { case Pair(code,percent) => cp = cp + percent; new Frequency(code.toByte,cp) } ) } } // We could use instances of Pair or Tuple2 but specific labels // make the code more readable than index numbers class Frequency(_code: Byte, _percent: Double){ var code = _code; var percent = _percent; } // extend the Java BufferedOutputStream class class FastaOutputStream(out: OutputStream) extends BufferedOutputStream(out) { private val LineLength = 60 private val nl = '\n'.toByte def writeDescription(desc: String) = { write( (">" + desc + "\n").getBytes ) } def writeRepeatingSequence(_alu: String, length: Int) = { val alu = _alu.getBytes var n = length; var k = 0; val kn = alu.length; while (n > 0) { val m = if (n < LineLength) n else LineLength var i = 0 while (i < m){ if (k == kn) k = 0 val b = alu(k) if (count < buf.length){ buf(count) = b; count = count + 1 } else { write(b) } // flush buffer k = k+1 i = i+1 } write(nl) n = n - LineLength } } def writeRandomSequence(distribution: Array[Frequency], length: Int) = { var n = length while (n > 0) { val m = if (n < LineLength) n else LineLength var i = 0 while (i < m){ val b = selectRandom(distribution) if (count < buf.length){ buf(count) = b; count = count + 1 } else { write(b) } // flush buffer i = i+1 } if (count < buf.length){ buf(count) = nl; count = count + 1 } else { write(nl) } // flush buffer n = n - LineLength } } private def selectRandom(distribution: Array[Frequency]): Byte = { val n = distribution.length val r = RandomNumber scaledTo(1.0) var i = 0 while (i < n) { if (r < distribution(i).percent) return distribution(i).code i = i+1 } return distribution(n-1).code } } object RandomNumber { private val IM = 139968 private val IA = 3877 private val IC = 29573 private var seed = 42 def scaledTo(max: Double) = { seed = (seed * IA + IC) % IM max * seed / IM } } Other Scala examples (source code examples)Here is a short list of links related to this Scala fasta.scala source code file: |
... this post is sponsored by my books ... | |
![]() #1 New Release! |
![]() FP Best Seller |
Copyright 1998-2024 Alvin Alexander, alvinalexander.com
All Rights Reserved.
A percentage of advertising revenue from
pages under the /java/jwarehouse
URI on this website is
paid back to open source projects.